|
MathWorks Inc
matlab release 2015a Matlab Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab release 2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab release 2015a - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab 2015 Matlab 2015, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab 2015/product/MathWorks Inc Average 96 stars, based on 1 article reviews
matlab 2015 - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
MathWorks Inc
function fminsearch matlab release 2015a Function Fminsearch Matlab Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/function fminsearch matlab release 2015a/product/MathWorks Inc Average 93 stars, based on 1 article reviews
function fminsearch matlab release 2015a - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
MathWorks Inc
image acquisition image processing toolboxes release 2015a  Image Acquisition Image Processing Toolboxes Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/image acquisition image processing toolboxes release 2015a/product/MathWorks Inc Average 96 stars, based on 1 article reviews
image acquisition image processing toolboxes release 2015a - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
MathWorks Inc
machine learning toolbox release 2015a Machine Learning Toolbox Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/machine learning toolbox release 2015a/product/MathWorks Inc Average 96 stars, based on 1 article reviews
machine learning toolbox release 2015a - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
MathWorks Inc
computing language software Computing Language Software, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/computing language software/product/MathWorks Inc Average 90 stars, based on 1 article reviews
computing language software - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab 2015a version Matlab 2015a Version, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab 2015a version/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab 2015a version - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
2015a  2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
2015a - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab environment Matlab Environment, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab environment/product/MathWorks Inc Average 96 stars, based on 1 article reviews
matlab environment - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
MathWorks Inc
statistics toolbox release 2015a Statistics Toolbox Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/statistics toolbox release 2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
statistics toolbox release 2015a - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
statistics and machine learning toolbox release 2015a Statistics And Machine Learning Toolbox Release 2015a, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/statistics and machine learning toolbox release 2015a/product/MathWorks Inc Average 90 stars, based on 1 article reviews
statistics and machine learning toolbox release 2015a - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: A Microglia Sublineage Protects from Sex-Linked Anxiety Symptoms and Obsessive Compulsion
doi: 10.1016/j.celrep.2019.09.045
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-RFP Rockland Cat#600-401-379; RRID:AB_2209751 anti-lba1 Wako Cat#019–19741; RRID:AB_839504 Alexa Fluor 555 Invitrogen Cat#A31572; RRID:AB_162543 anti CD11b-APC BioLegend Cat#101212; RRID: AB_312795 anti CD45-FITC BioLegend Cat#103108; RRID: AB_312973 Chemicals, Peptides, and Recombinant Proteins Urocortin II Millipore-Sigma Cat# U9507 Trilostane Millipore-Sigma Cat#SML0141 Estrogen Millipore-Sigma Cat#PHR1353 Progesterone Millipore-Sigma Cat#P3972 Critical Commercial Assays Cortisol ELISA Kit Arbor Assays Cat#K003 Estradiol ELISA Kit Arbor Assays Cat#K030 Progesterone ELISA Kit Arbor Assays Cat#K025 Creatinine Urinary Detection Kit Arbor Assays Cat#K002 Deposited Data raw and analyzed data This paper N/A Experimental Models: Organisms/Strains Hoxb8 ko Mario Capecchi RRID 4818890 Hoxb8 IRES-Cre Mario Capecchi RRID 4837097 Hoxb8 mut-IRES-Cre This paper N/A Csf1r flox The Jackson Laboratory Stock# 021212; RRID 3653677 Rosa26 lsl-tdTomato The Jackson Laboratory Stock# 007914; RRID 4436847 Oligonucleotides Hoxb8 mut-IRES-Cre genotyping primer: gccagacctacagtcgctacca (forward) This paper N/A Hoxb8 mut-IRES-Cre genotyping primer: cttcttgtcacccttctgcgcatcg (reverse) This paper N/A Software and Algorithms MATLAB and
Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Software
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial component of an induced magnetic field for Re m . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential component of an induced magnetic field for Re m . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial velocity profile for R 1 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential velocity profile for R 1 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial component of induced magnetic field for R 1 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential component induced magnetic field for R 1 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial velocity profile for R 2 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential velocity profile for R 2 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial component of induced magnetic field for R 2 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential component of induced magnetic field for R 2 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Upper disk torque for R 2 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Variation of temperature profile for Pr. Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial velocity profile for S . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential velocity profile for S . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Axial induced magnetic field for S . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Tangential induced magnetic field for S . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Variation of concentration profile for k 1 and k 2 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Concentration Assay, Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Variation of concentration profile for Sc . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html .
Article Snippet: Image generated by using
Techniques: Concentration Assay, Generated
Journal: Scientific Reports
Article Title: Significance of magnetic Reynolds number in a three-dimensional squeezing Darcy–Forchheimer hydromagnetic nanofluid thin-film flow between two rotating disks
doi: 10.1038/s41598-020-74142-5
Figure Lengend Snippet: Variation of a tangential velocity profile for C 1 . Image generated by using MATLAB 2015a https://www.mathworks.com/help/simulink/release-notes-R2015a.html1 .
Article Snippet: Image generated by using
Techniques: Generated